Chapter 1: Understanding the Concept of Life

The precise definition of life has been a topic of intense discussion among scientists for years. For our purposes, we will adhere to NASA's definition: "Life is a self-sustaining chemical system capable of Darwinian evolution." This definition implies that a chemical system needs to fulfill two essential criteria: it must possess the ability to organize itself and replicate. Various chemicals can self-organize; for instance, even a simple blob of fat in a meat broth demonstrates self-organization. Uncharged (apolar) fat molecules tend to form a spherical shape in water, optimizing their surface-to-volume ratio and achieving energy efficiency in relation to charged (polar) water molecules. Because fat is less dense than water, these droplets rise to the surface, where they reshape into thin circular layers, representing a stable energetic configuration.

Some fats are partially polar, having a charged end that interacts with water (hydrophilic) and an uncharged end that repels water (hydrophobic). These are termed amphiphilic. In water, they create a bilayer structure, with hydrophilic ends exposed to the water and hydrophobic ends tucked inward, forming a membrane. To attain the most energetically favorable state, this membrane can encapsulate itself into a bubble, ensuring that no hydrophobic regions are exposed to water. Such structures, known as lipid vesicles or liposomes, are fundamental to life. They establish a separation between internal and external environments, providing a crucial basis for spatial organization and compartmentalization. These amphiphiles likely formed abiotically around undersea volcanic eruptions or mineral surfaces, creating small, isolated spaces in the lifeless primordial ocean. Eventually, these liposomes may have absorbed RNA, shielding it from direct environmental exposure.

One critical principle of chemistry that has often been overlooked is entropy. By nature, every chemical system seeks maximum disorder. Maintaining order demands energy to counteract the relentless tendency toward chaos. As a system grows in complexity, the potential for disorder rises, necessitating even more energy to uphold order. Liposomes facilitated complex organization and ultimately life by addressing the challenge of disorder through a two-dimensional boundary—a surface that delineates space.

While the exact path of abiogenesis remains unclear, let’s envision a hypothetical scenario: Picture a liposome filled with various RNA molecules in a state of chaos. This system is isolated from the external environment by a membrane. Over time, certain RNA strands may develop catalytic properties, leading to the emergence of ribozymes. It’s conceivable that the earliest ribozymes capable of ligating (joining) two RNA strands were formed. Such ribozymes are known as RNA ligases. Remarkably, even a short RNA sequence can theoretically function as a ligase.

To grasp this concept, we must consider RNA's properties: the base pairing principles that apply to DNA also hold for RNA, albeit less stably. Thus, two different RNA strands can form a double helix if they share complementary nucleotide segments. If an RNA ligase encounters two RNA sequences, X and Y, that correspond to its own base sequence, these strands can “stick together.” When the ends of X and Y come close, a catalytic reaction can occur, facilitated by magnesium ions present in the primordial soup and inside our liposome. However, the ligase can only bind those RNA sequences that complement its structure.

Let's consider the ligation process:

Ligase

…AAGGCCUUAAGGCCUUAAGGCCUUGAGCUAGCUAGCUAGCUAGCUAGCU…

UUCCGGAAUUCCGGAAUUCCGGAAUCGAUCGAUCGAUCGAUCGAUCGA

X Y

UUCCGGAAUUCCGGAAUUCCGGAACUCGAUCGAUCGAUCGAUCGAUCGA

XY

RNA strands X and Y can be ligated when cytidine triphosphate (CTP) is introduced, resulting in the release of pyrophosphate. The electrostatic bond that maintains an RNA double strand is inherently weaker than that of a DNA double helix, causing the newly formed RNA XY to detach from the ligase after a short time. The implications of this process are significant: larger RNA molecules, which partially resemble the ligase that generated them, can form. Over time, networks of ligases may develop within our liposome, capable of self-replication.

In a groundbreaking experiment published in Science in 2009, Tracey L. Lincoln and Gerald F. Joyce demonstrated how one ligase, A, can produce a second ligase, A', from two smaller RNA molecules (Y' and X'). This new ligase A' can then ligate two other RNAs (Y and X) into an RNA that is identical to the original ligase A, effectively establishing a self-replicating system. This scenario brings us closer to satisfying the two established conditions for life. However, since only individual RNA molecules can replicate, and not the entire system, it may be premature to claim that life exists at this stage.

Chapter 2: The Evolution of Ligase Systems

The emergence of a two-ligase system, while seemingly unlikely, could represent a natural progression from the first ligase. New RNA ligases likely share structural characteristics with their progenitor ligase, making them predisposed to function similarly. This raises the possibility that complex networks, such as the aforementioned two-ligase systems, could evolve over time. Given the extensive timescale available during the early stages of our planet, random processes could lead to the development of larger ligases from smaller variants. Gradually, a sophisticated network of interacting ribozymes may have emerged from the initial disorder of non-functional RNA.

This video titled "The RNA World & Why Time Works Against Abiogenesis" explores the challenges and implications of the RNA World hypothesis, shedding light on the intricate relationships between time, evolution, and the origins of life.

In this video, "The RNA world with Jack Szostak | Late Night Conference with Wilhelm Huck 1x03," Jack Szostak discusses the RNA World hypothesis, providing insights into the foundational concepts behind abiogenesis and the evolution of life.